{"id":9700,"date":"2018-10-09T12:52:58","date_gmt":"2018-10-09T03:52:58","guid":{"rendered":"http:\/\/cell.brc.riken.jp\/en\/?page_id=9700"},"modified":"2025-05-21T16:20:22","modified_gmt":"2025-05-21T07:20:22","slug":"dna_barcoding","status":"publish","type":"page","link":"http:\/\/cell.brc.riken.jp\/en\/quality\/dna_barcoding","title":{"rendered":"DNA barcoding analysis"},"content":{"rendered":"

Our bank conducts DNA barcoding tests to identify the animal species of origin of cells. This test amplifies the DNA barcode (a short nucleotide sequence of a specific gene region)*1<\/sup> by PCR and then performs DNA sequencing of the PCR products.<\/p>\n

By comparing the sequencing results with the nucleotide sequences of various animals registered in public databases*2<\/sup>, we can identify the animal species. With the advancement of DNA sequencing technology, DNA barcode sequencing has been performed on various animal species, and the results are now registered in public databases, making it possible to apply this method to species identification.<\/p>\n

*1<\/sup> DNA barcode used for identifying animal species of origin of the cell lines in our cell bank.
\nOur bank uses the mitochondrial Cytochrome c Oxidase subunit I (COI) gene.
\nIf identification of the animal species cannot be achieved with the COI gene alone, we also analyze other gene sequences from animal species for which data are reported, such as Cytochrome b (Cytb) and 16S rRNA.<\/p>\n

*2<\/sup> Public Databases for identifying animal species of origin
\nBarcode of Life Data Systems\uff08BOLD\uff09\u3000
\nhttp:\/\/www.boldsystems.org\/<\/a>
\nNational Center for Biotechnology Information \u2013 BLAST (Basic Local Alignment Search Tool)
\nhttps:\/\/blast.ncbi.nlm.nih.gov\/Blast.cgi<\/a><\/p>\n

1. Test Procedure<\/strong>
\n\u2460 DNA Extraction \u2192 \u2461 PCR amplification of DNA barcode region \u2192 \u2462 Confirmation by gel electrophoresis \u2192 \u2463 Purification of amplified product \u2192 \u2464 DNA Sequencing \u2192 \u2465 Analysis using public databases<\/p>\n

2. Items to Prepare<\/strong>
\n(1) Sample: Genomic DNA extracted from cells
\n(2) Equipment: Thermal cycler, such as Applied Biosystems\u00ae Veriti\u00ae Thermal Cycler
\n(3) PCR Primers
\nA) Cocktail primers for amplifying the COI gene
\nUniversal primer cocktails *<\/sup>These primers amplify a wide range of animal species.
\nMammalian primer mix for routine COI barcoding (Ivanova et al, 2007. Mol Ecol Notes 7:544-548)
\n*<\/sup>In the original method, M13 sequences were added for sequencing; however, in the method of our bank SP6 and T7 sequences were added for sequencing to the forward and reverse primers, respectively.<\/p>\n

C_VF1LFt1_SP6 Forward primer cocktails (mixed in a 1:1:1:3 ratio)<\/p>\n

\n
\n
1x LepF1_t1\uff1a\n<\/div>\n
5\u2019- ATTTAGGTGACACTATAG<\/span>A<\/span>T<\/span>T<\/span>C<\/span>A<\/span>A<\/span>C<\/span>C<\/span>A<\/span>A<\/span>T<\/span>C<\/span>A<\/span>T<\/span>A<\/span>A<\/span>A<\/span>G<\/span>A<\/span>T<\/span>A<\/span>T<\/span>T<\/span>G<\/span>G<\/span> -3\u2019<\/tt>\n<\/div>\n<\/div>\n
\n
1x VF1_t1\uff1a\n<\/div>\n
5\u2019- ATTTAGGTGACACTATAG<\/span>T<\/span>C<\/span>T<\/span>C<\/span>A<\/span>A<\/span>C<\/span>C<\/span>A<\/span>A<\/span>C<\/span>C<\/span>A<\/span>C<\/span>A<\/span>A<\/span>A<\/span>G<\/span>A<\/span>C<\/span>A<\/span>T<\/span>T<\/span>G<\/span>G<\/span> -3\u2019<\/tt>\n<\/div>\n<\/div>\n
\n
1x VF1d_t1\uff1a\n<\/div>\n
5\u2019- ATTTAGGTGACACTATAG<\/span>T<\/span>C<\/span>T<\/span>C<\/span>A<\/span>A<\/span>C<\/span>C<\/span>A<\/span>A<\/span>C<\/span>C<\/span>A<\/span>C<\/span>A<\/span>A<\/span>RG<\/span>A<\/span>YA<\/span>T<\/span>YG<\/span>G<\/span> -3\u2019<\/tt>\n<\/div>\n<\/div>\n
\n
3x VF1i_t1\uff1a\n<\/div>\n
5\u2019- ATTTAGGTGACACTATAG<\/span>T<\/span>C<\/span>T<\/span>C<\/span>A<\/span>A<\/span>C<\/span>C<\/span>A<\/span>A<\/span>C<\/span>C<\/span>A<\/span>NA<\/span>A<\/span>NG<\/span>A<\/span>NA<\/span>T<\/span>NG<\/span>G<\/span> -3\u2019<\/tt>\n<\/div>\n<\/div>\n<\/div>\n

C_VR1LRt1_T7 Reverse primer cocktails (mixed in a 1:1:1:3 ratio)<\/p>\n

\n
\n
1x LepR1_t1\uff1a\n<\/div>\n
5\u2019- TAATACGACTCACTATAGGG<\/span>T<\/span>A<\/span>A<\/span>A<\/span>C<\/span>T<\/span>T<\/span>C<\/span>T<\/span>G<\/span>G<\/span>A<\/span>T<\/span>G<\/span>T<\/span>C<\/span>C<\/span>A<\/span>A<\/span>A<\/span>A<\/span>A<\/span>A<\/span>T<\/span>C<\/span>A<\/span> -3\u2019<\/tt>\n<\/div>\n<\/div>\n
\n
1x VR1_t1\uff1a\n<\/div>\n
5\u2019- TAATACGACTCACTATAGGG<\/span>T<\/span>A<\/span>G<\/span>A<\/span>C<\/span>T<\/span>T<\/span>C<\/span>T<\/span>G<\/span>G<\/span>G<\/span>T<\/span>G<\/span>G<\/span>C<\/span>C<\/span>A<\/span>A<\/span>A<\/span>G<\/span>A<\/span>A<\/span>T<\/span>C<\/span>A<\/span> -3\u2019<\/tt>\n<\/div>\n<\/div>\n
\n
1x VR1d_t1\uff1a\n<\/div>\n
5\u2019- TAATACGACTCACTATAGGG<\/span>T<\/span>A<\/span>G<\/span>A<\/span>C<\/span>T<\/span>T<\/span>C<\/span>T<\/span>G<\/span>G<\/span>G<\/span>T<\/span>G<\/span>G<\/span>C<\/span>C<\/span>RA<\/span>A<\/span>RA<\/span>A<\/span>YC<\/span>A<\/span> -3\u2019<\/tt>\n<\/div>\n<\/div>\n
\n
3x VR1i_t1\uff1a\n<\/div>\n
5\u2019- TAATACGACTCACTATAGGG<\/span>T<\/span>A<\/span>G<\/span>A<\/span>C<\/span>T<\/span>T<\/span>C<\/span>T<\/span>G<\/span>G<\/span>G<\/span>T<\/span>G<\/span>NC<\/span>C<\/span>NA<\/span>A<\/span>NA<\/span>A<\/span>NC<\/span>A<\/span> -3\u2019<\/tt>\n<\/div>\n<\/div>\n<\/div>\n

B) Species-specific primers for amplifying the COI gene *<\/sup>These primers are designed to amplify specific animal species.
\nIn some cases, the cocktail primers in A) may not work well for amplification or sequencing. If the specific COI gene primers set or the COI gene sequence information of the target animal species is publicly available, our bank will construct species-specific primers and use them for amplification.<\/p>\n

C) Primers for amplifying DNA barcodes other than the COI gene
\nThe availability of COI gene database registration varies among animal species. Especially for “Asian endemic species” or subspecies of the same animal species from different habitats, there may be none or very few database registration, making identification difficult. In such cases, we search for alternative methods using other species- or subspecies-specific genes in medical reference databases, and construct primers for amplification.<\/p>\n

D) Sequencing Primers
\nIf the gene amplification primers in A) to C) are added with universal sequences such as SP6 or T7, these universal sequences are used as sequencing primers. If no universal sequences are added, the same primers used for gene amplification are used for sequencing.<\/p>\n

\n
\n
SP6\uff1a\n<\/div>\n
5\u2019- ATTTAGGTGACACTATAG<\/span> -3\u2019<\/tt>\n<\/div>\n<\/div>\n
\n
T7\uff1a\n<\/div>\n
5\u2019- TAATACGACTCACTATAGGG<\/span> -3\u2019<\/tt>\n<\/div>\n<\/div>\n<\/div>\n

3. Method<\/strong>
\n\uff0a<\/sup>The following describes the procedure using “A) Cocktail primers for amplifying the COI gene.” For PCR conditions using other primers, please refer to the references.
\n(1) PCR reaction mixture (for 1 reaction)
\n\uff0a<\/sup>If band excision and purification are required before sequencing, prepare multiple reactions.<\/p>\n\n\n\n\n\n\n\n\n\n\n
10X Ex Taq Buffer<\/td>\n5.0 \u03bcL<\/td>\n<\/tr>\n
dNTP Mixture (2.5 mM each)\t<\/td>\n4.0 \u03bcL<\/td>\n<\/tr>\n
Forward Primer [C_VF1LFt1_SP6] (10 \u03bcM)<\/td>\n0.5 \u03bcL<\/td>\n<\/tr>\n
Reverse Primer [C_VR1LRt1_T7] (10 \u03bcM)<\/td>\n0.5 \u03bcL<\/td>\n<\/tr>\n
TaKaRa Ex Taq HS (5 units\/\u03bcL)<\/td>\n0.25 \u03bcL<\/td>\n<\/tr>\n
DDW<\/td>\n37.75 \u03bcL<\/td>\n<\/tr>\n
\n
\n<\/td>\n<\/tr>\n
Total<\/td>\n48.0 \u03bcL<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

(2) Dispense 48 \u03bcL of PCR reaction mixture into a PCR tube, and add 20ng (10ng\/\u03bcL, 2\u03bcL) of template DNA from the sample to each tube.<\/p>\n

(3) PCR Cycle<\/p>\n

\"pcr_cycle\"<\/a><\/p>\n

(4) Confirmation by Gel Electrophoresis Example results (using 2% agarose gel)<\/p>\n

\"agarose\"<\/a><\/p>\n

(5) Purification and absorbance measurement of amplified products
\nPurify the amplified product using commercially available PCR purification kits or gel extraction kits. Next, measure the absorbance of the amplified product and adjust it to the required concentration for sequencing analysis.<\/p>\n

QIAquick PCR Purification Kit (50 \/ 250)\uff08Cat No. 28104 \/ 28106\uff09
\nQIAquick Gel Extraction Kit (50 \/ 250)\uff08Cat No. 28704 \/ 28706\uff09 etc.<\/p>\n

(6) Perform DNA sequencing analysis using a capillary sequencer with the Sanger method.
\nOnce the sequence data and chromatogram are obtained, clean the poorly read regions at the “start” and “end” to create a consensus sequence.<\/p>\n

\"sanger\"<\/a><\/p>\n

(7) Result analysis
\nEnter the consensus sequence into the “Barcode of Life Data Systems (BOLD)” for analysis.
\nExample of analysis results: RCB2943 OLHdrR-e3
\nhttps:\/\/cellbank.brc.riken.jp\/cell_bank\/CellInfo\/?cellNo=RCB2943&lang=en<\/a>
\nIdentified species: Oryzias latipes<\/em> 100%<\/p>\n

\"BOLD_v5_01\"<\/a><\/p>\n

\"BOLD_v5_02\"<\/a><\/p>\n

Comparison of COI gene sequences (cell lines derived from Oryzias latipes<\/em>)<\/p>\n\n\n\n\n\n\n\n\n
\u2460 Oryzias latipes<\/em> COI gene, strain: Hd-rR
https:\/\/www.ncbi.nlm.nih.gov\/nuccore\/AB498065<\/a><\/td>\n		\u2466 Oryzias latipes<\/em> COI gene
https:\/\/www.ncbi.nlm.nih.gov\/nuccore\/NC_004387<\/a><\/td>\n<\/tr>\n
\u2461 RCB0187 OLHE-131 Lot.1 \uff1aOLHE-131<\/td>\n\u2467 RCB0184 OLF-136 Lot.1 \uff1aOLF-136<\/td>\n<\/tr>\n
\u2462 RCB2943 OLHdrR-e3 Lot.1 \uff1aOLHdrR-e3<\/td>\n\u2468 RCB0188 OLME-104 Lot.2 \uff1aOLME-104<\/td>\n<\/tr>\n
\u2463 RCB2944 OLCAB-e31 Lot.1 \uff1aOLCAB-e31<\/td>\n\u2469 Oryzias latipes<\/em>COI gene, strain: HNI
https:\/\/www.ncbi.nlm.nih.gov\/nuccore\/AB498066<\/a><\/td>\n<\/tr>\n
\u2464 RCB2945 DIT29 Lot.1 \uff1aDIT29<\/td>\n\u246a RCB2942 OLHNI-2 Lot.1 \uff1aOLHNI-2<\/td>\n<\/tr>\n
\u2465 RCB2946 OLCAB-e3 Lot.1 \uff1aOLCAB-e3<\/td>\n<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

\"medaka_3\"<\/a><\/p>\n

4. Interpretation of the result<\/strong>
\nIf the analysis result from BOLD’s “Species Level Barcode Records” shows a match rate of 95% or higher and the species matches the deposited information, it will be considered a pass.
\nThere are various cases depending on the animal species, such as “low match rate,” “no or few database registration,” “high match rate but unable to identify the subspecies,” “species name changed or reclassified due to new findings,” or “disagreement on the species name.” If identification cannot be achieved with the COI gene alone, alternative gene analysis methods will be considered, and a comprehensive judgment will be made.<\/p>\n

5. References
\nAlmeida, J.L., Cole, K.D., and Plant, A.L.
\nStandards for Cell Line Authentication and Beyond.
\nPLoS Biol<\/em> 14: e1002476 (2016)<\/a>.<\/p>\n

Hebert PD, Cywinska A, Ball SL, deWaard JR.
\nBiological identifications through DNA barcodes.
\nProc Biol Sci.<\/em> 2003 Feb 7;270(1512):313-21. doi:10.1098\/rspb.2002.2218. PMID: 12614582<\/a>; PMCID: PMC1691236.<\/p>\n","protected":false},"excerpt":{"rendered":"

Our bank conducts DNA barcoding tests to identify the animal species of origin of cells. This test amplifies the DNA barcode (a short nucleotide sequence of a specific gene region)*1 by PCR and then performs DNA sequencing of the PCR products. By comparing the sequencing results with the nucleotide sequences of various animals registered in public databases*2, we can identify the animal species. With the advancement of DNA sequencing technology, DNA barcode sequencing has been performed on various animal species, and the results are now registered in public databases, making it possible to apply this method to species identification. *1 DNA barcode used for identifying animal species of origin of the cell lines in our cell bank. Our bank uses the mitochondrial Cytochrome c Oxidase subunit I (COI) gene. If identification of the animal species cannot be achieved with the COI gene alone, we also analyze other gene sequences from animal species for which data are reported, such as Cytochrome b (Cytb) and 16S rRNA. *2 Public Databases for identifying animal species of origin Barcode of Life Data Systems\uff08BOLD\uff09\u3000 http:\/\/www.boldsystems.org\/ National Center for Biotechnology Information \u2013 BLAST (Basic Local Alignment Search Tool) https:\/\/blast.ncbi.nlm.nih.gov\/Blast.cgi 1. Test Procedure \u2460 DNA Extraction \u2192 […]<\/p>\n","protected":false},"author":15,"featured_media":0,"parent":9319,"menu_order":0,"comment_status":"closed","ping_status":"closed","template":"","meta":{"_seopress_robots_primary_cat":"","_seopress_titles_title":"","_seopress_titles_desc":"","_seopress_robots_index":"","footnotes":"","_wp_rev_ctl_limit":""},"class_list":["post-9700","page","type-page","status-publish","hentry"],"_links":{"self":[{"href":"http:\/\/cell.brc.riken.jp\/en\/wp-json\/wp\/v2\/pages\/9700","targetHints":{"allow":["GET"]}}],"collection":[{"href":"http:\/\/cell.brc.riken.jp\/en\/wp-json\/wp\/v2\/pages"}],"about":[{"href":"http:\/\/cell.brc.riken.jp\/en\/wp-json\/wp\/v2\/types\/page"}],"author":[{"embeddable":true,"href":"http:\/\/cell.brc.riken.jp\/en\/wp-json\/wp\/v2\/users\/15"}],"replies":[{"embeddable":true,"href":"http:\/\/cell.brc.riken.jp\/en\/wp-json\/wp\/v2\/comments?post=9700"}],"version-history":[{"count":3,"href":"http:\/\/cell.brc.riken.jp\/en\/wp-json\/wp\/v2\/pages\/9700\/revisions"}],"predecessor-version":[{"id":11055,"href":"http:\/\/cell.brc.riken.jp\/en\/wp-json\/wp\/v2\/pages\/9700\/revisions\/11055"}],"up":[{"embeddable":true,"href":"http:\/\/cell.brc.riken.jp\/en\/wp-json\/wp\/v2\/pages\/9319"}],"wp:attachment":[{"href":"http:\/\/cell.brc.riken.jp\/en\/wp-json\/wp\/v2\/media?parent=9700"}],"curies":[{"name":"wp","href":"https:\/\/api.w.org\/{rel}","templated":true}]}}